Tetracycline antibiotics (TCs) are one kind of broad spectrum bacteriostatic agents.
However, excessive use of TCs will have a threat to the environment and human health …

A colorimetric aptasensor was developed for selective and sensitive detection of Salmonella
typhimurium (S. typhimurium) based on the enhancement of bacteria for the peroxidase-like …

Tetracycline and Eu 3+, while coexisting, usually appear as a complex by chelating. This
complex shows low fluorescence intensity, leading to its limitation of analytical goals. Gold …

Misuse of antibiotics has recently been considered a global issue because of its harmful
effects on human health. Since conventional methods have numerous limitations, it is …

We have successfully developed a novel colorimetric aptasensor using gold nanoparticles
for highly sensitive and specific detection of oxytetracycline (OTC), one of the most common …

A new sandwich assay for tetracycline (TC) involving a DNA aptamer and antibody pair is
demonstrated in conjunction with gold nanostar (GNS) enhanced surface plasmon …

This paper investigated a new detection method of oxytetracycline (OTC) in aquatic products
with ultrasensitive detection limit. The method was constructed on the basis of raman hot …

With increasing concerns related to the abuse of antibiotics in livestock production
worldwide, simple and rapid screening methods for monitoring antibiotics in animal-derived …

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (
TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity …

It is of great importance to detect chlorotetracycline (CTC) in a highly sensitive and specific
way because of its wide distribution in aquaculture and animal husbandry. Herein, we …