Aptamers are short, single-stranded oligonucleotides that bind to specific target molecules.
The shape-forming feature of single-stranded oligonucleotides provides high affinity and …

Nucleic acid aptamers can be selected from pools of random-sequence oligonucleotides to
bind a wide range of biomedically relevant proteins with affinities and specificities that are …

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (
TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity …

Aptasensors have attracted considerable interest and widespread application in point-of-
care testing worldwide. One of the biggest challenges of a point-of-care (POC) is the …

Molecular imaging, first developed to localise antigens in light microscopy, now
encompasses all imaging modalities including those used in clinical care: optical imaging …

Thrombus formation is of paramount importance in the pathophysiology of acute ischemic
stroke. Current antithrombotics used to treat or prevent cerebral ischemia are only …

Adhesive interactions between circulating sickle red blood cells (RBCs), leukocytes, and
endothelial cells are major pathophysiologic events in sickle cell disease (SCD). To develop …

The prevention of excessive blood loss to avoid fatal haemorrhage is a pivotal process for all
organisms possessing a circulatory system. Increased circulating blood volume and …

Potential applications for functional RNAs are rapidly expanding, not only to address
functions based on primary nucleotide sequences, but also by RNA aptamer, which can …

Aptamers are short single-stranded nucleic acids with high affinity to target molecules and
are applicable to therapeutics and diagnostics. Regardless of an increasing number of …