[HTML][HTML] Poor cognitive ageing: Vulnerabilities, mechanisms and the impact of nutritional interventions
Background Ageing is a highly complex process marked by a temporal cascade of events,
which promote alterations in the normal functioning of an individual organism. The triggers …
which promote alterations in the normal functioning of an individual organism. The triggers …
Cathepsins in the pathophysiology of mucopolysaccharidoses: new perspectives for therapy
Cathepsins (CTSs) are ubiquitously expressed proteases normally found in the
endolysosomal compartment where they mediate protein degradation and turnover …
endolysosomal compartment where they mediate protein degradation and turnover …
The role of lysosomes in a broad disease-modifying approach evaluated across transgenic mouse models of Alzheimer's disease and Parkinson's disease and …
J Hwang, CM Estick, US Ikonne, D Butler… - International journal of …, 2019 - mdpi.com
Many neurodegenerative disorders have lysosomal impediments, and the list of proposed
treatments targeting lysosomes is growing. We investigated the role of lysosomes in …
treatments targeting lysosomes is growing. We investigated the role of lysosomes in …
Endosomal-lysosomal dysfunction in metabolic diseases and Alzheimer's disease
MF Almeida, BA Bahr, ST Kinsey - International review of neurobiology, 2020 - Elsevier
The endosomal-lysosomal pathways and related autophagic processes are responsible for
proteostasis, involving complexes between lysosomes and autophagosomes. Lysosomes …
proteostasis, involving complexes between lysosomes and autophagosomes. Lysosomes …
[HTML][HTML] Engulfment and cell motility protein 1 potentiates diabetic cardiomyopathy via Rac-dependent and Rac-independent ROS production
M Kakoki, EM Bahnson, JR Hagaman, RM Siletzky… - JCI insight, 2019 - ncbi.nlm.nih.gov
Engulfment and cell motility protein 1 (ELMO1) is part of a guanine nucleotide exchange
factor for Ras-related C3 botulinum toxin substrate (Rac), and ELMO1 polymorphisms were …
factor for Ras-related C3 botulinum toxin substrate (Rac), and ELMO1 polymorphisms were …
[HTML][HTML] Effect of Andrographis paniculata polysaccharide on human retinoblastoma Y79 cell proliferation and apoptosis
B Xu, L Li, W Zhang, Y Li, MR Wang… - International Journal …, 2021 - ncbi.nlm.nih.gov
AIM To explore the effect of the Andrographis paniculata (A. paniculata) polysaccharide on
the proliferation and apoptosis of human retinoblastoma (RB) Y79 cells and its mechanism …
the proliferation and apoptosis of human retinoblastoma (RB) Y79 cells and its mechanism …
Novel Method for Collecting Hippocampal Interstitial Fluid Extracellular Vesicles (EVISF) in a Mouse Model of Alzheimer's Disease
MC Pait - 2023 - search.proquest.com
Methods In vivo microdialysis was used to collect hippocampal ISF from 3-and 9-month-old,
unanaesthetized, unrestrained, APPswe/PS1ΔE9 (APP/PS1), a mouse model of Aβ …
unanaesthetized, unrestrained, APPswe/PS1ΔE9 (APP/PS1), a mouse model of Aβ …
[PDF][PDF] Poor cognitive ageing: vulnerabilities, mechanisms and the impact of
Background: Ageing is a highly complex process marked by a temporal cascade of events,
which promote alterations in the normal functioning of an individual organism. The triggers …
which promote alterations in the normal functioning of an individual organism. The triggers …
Supplemental table 1. Baseline characteristics of included patients.
J Rao - Gut, 2023 - gut.bmj.com
Gene Forward Primer (5′→ 3′) Reverse Primer (5′→ 3′) FSTL1 (Human)
GCCATGACCTGTGACGGAAA CAGCGCTGAAGTGGAGAAGA Collagen I (Human) …
GCCATGACCTGTGACGGAAA CAGCGCTGAAGTGGAGAAGA Collagen I (Human) …